|
|
| Mus_musculus snoMBII-202 | |
| sequence |
TGATGACATTCTCCGGAATCGCTGTACTGACTTGATGAAAGTACTTTTGAACCCTTTTC
CATCTGATGACACCGAGTTTTCTC
Box motif
Complementary to target RNA |
| length | 83 |
| organism | Mus_musculus |
| snoRNA name | snoMBII-202 |
| alias | |
| chromosome ⁄ contig | 8 |
| locus ⁄ host gene | Rpl13 |
| organization | Intronic |
| target RNA | 18S rRNA, 28S rRNA |
| modification type | C/D |
| modification site | 18S:U429,28S:A2256 |
| accession no | |
| orthologs | list |
| multiple alignment | |