snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA26
sequence
AAGACACACAGAGGATACTTTAAAAGGCTAACACAGAAGGGCAAAGGAACTCTCTATAA
AACCCAGAGGGGAAAACTACACCTTCTCTTAGGATCCTGTCTGGAGTCACAGAT
  Box motif
  Complementary to target RNA
length 113
organism Mus_musculus
snoRNA name SNORA26
alias HBI-6
chromosome ⁄ contig 1
locus ⁄ host gene Mtap2
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4204
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved