snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA24
sequence
TTCAGGTCTCTTTGTGACCTGTCAACTATGACAACCCCACTTCATAGCCACAGAAGAAC
ATGGCGAAGCTGTCACCATTTAATTGGTGTCTGGTTCTGATTCACATAGATAACATTC
  Box motif
  Complementary to target RNA
length 117
organism Mus_musculus
snoRNA name SNORA24
alias ACA24
chromosome ⁄ contig 10
locus ⁄ host gene Mono:232:SNORA24
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U864,18S:U610
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved