|
|
| Mus_musculus SNORD52 | |
| sequence |
GAGAGTGATGATTTCACAGACTAGAGTCTCTGACGCTGTCCTTGATGTCAGCTATAAAT
CTGACTC
Box motif
Complementary to target RNA |
| length | 66 |
| organism | Mus_musculus |
| snoRNA name | SNORD52 |
| alias | |
| chromosome ⁄ contig | 17 |
| locus ⁄ host gene | Poly:10:SNORD52 |
| organization | Poly |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | 28S:U3581 |
| accession no | |
| orthologs | list |
| multiple alignment | |