snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA70
sequence
CCAGAGTCTCATAAAAGAATCCAAAAATGTACAATAGCTGCCAACAGCAACCTTCTAGG
TAGTGTATGCAACCTGTTGTCTGTATGGGTTGTCCTAAAACATCTTGAAGATAGTA
  Box motif
  Complementary to target RNA
length 115
organism Mus_musculus
snoRNA name SNORA70
alias U70
chromosome ⁄ contig 11
locus ⁄ host gene Mono:421:SNORA70
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1692
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved