snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA63
sequence
ATGCAGGTACAGTTACAATGTTTCATTGTCTTTGCCCCTGCTTAAAGCATTTGATGCAT
TACTATCTCTGCCTAGCTCTACCATAGGAATGGTTTCTAACAT
  Box motif
  Complementary to target RNA
length 102
organism Mus_musculus
snoRNA name SNORA63
alias E3
chromosome ⁄ contig 11
locus ⁄ host gene Mono:424:SNORA63
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4072
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved