snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA46
sequence
AGCACTATATTTAAACCTATGGATGGGAAATTTCCCCACTCTGGATTACGCTGTAGTGC
AAAAAGAATTCCTGGCTCTGTGTTGCACAGCTGATTCATGCCATGGCTCCGTG
  Box motif
  Complementary to target RNA
length 112
organism Mus_musculus
snoRNA name SNORA46
alias ACA46
chromosome ⁄ contig 6
locus ⁄ host gene Mono:37:SNORA46
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U650
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved