snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA28
sequence
TGCATACATTCTCTGACACAGTTTGAGCTTACTAAAGCAACAAAGTCTAACCTATTCCA
GTGCTCTCTTTCGCATGAGGCAAGCTGTCATACAGGCTCAAAGAAA
  Box motif
  Complementary to target RNA
length 105
organism Mus_musculus
snoRNA name SNORA28
alias ACA28
chromosome ⁄ contig 9
locus ⁄ host gene Mono:342:SNORA28
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U816,18S:U867
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved