|
|
| Mus_musculus SNORD115-15 | |
| sequence |
GGGTCAATGATGACAACCCAATGTCATGAACAAAGGTGATGACATAAAATTCATGCTCA
ATAGGATTACGCTGAGGCCC
Box motif
Complementary to target RNA |
| length | 79 |
| organism | Mus_musculus |
| snoRNA name | SNORD115-15 |
| alias | |
| chromosome ⁄ contig | 7 |
| locus ⁄ host gene | Poly:SNORD115 |
| organization | Poly |
| target RNA | Unknown |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |