|
|
| Mus_musculus SNORD95 | |
| sequence |
TACAGATACAAGACCTCAACATGCCATCTAACTGTGGAGCTGAAAATCCAGAGGCTGTT
TTTGTACTC
Box motif
Complementary to target RNA |
| length | 68 |
| organism | Mus_musculus |
| snoRNA name | SNORD95 |
| alias | |
| chromosome ⁄ contig | 8 |
| locus ⁄ host gene | Mono:141:SNORD95 |
| organization | Mono |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | 28S:A2568, 28S:C2577 |
| accession no | |
| orthologs | list |
| multiple alignment | |