|
|
| Microcebus_murinus SNORD42 | |
| sequence |
GGGCAAATGAGAGAAAGATAATTATCTGGAAAAGAGTGACAGGAACAAAGGAACCACTT
AAATGCCA
Box motif
Complementary to target RNA |
| length | 67 |
| organism | Microcebus_murinus |
| snoRNA name | SNORD42 |
| alias | |
| chromosome ⁄ contig | GeneScaffold_49 |
| locus ⁄ host gene | Poly:17:SNORD42 |
| organization | Poly |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |