|
|
| Hordeum_vulgare snoR28 | |
| sequence |
AATGACGGAGATGATGTATTTTATTGCGAATATGAGTATGATATACATTGGCATAATTT
TAAGCGTCTGGCAGATATT
Box motif
Complementary to target RNA |
| length | 78 |
| organism | Hordeum_vulgare |
| snoRNA name | snoR28 |
| alias | |
| chromosome ⁄ contig | chr7H |
| locus ⁄ host gene | mono:snoR28 |
| organization | Mono |
| target RNA | |
| modification type | |
| modification site | |
| accession no | |
| orthologs | |
| multiple alignment | |