|
|
| Hordeum_vulgare snoZ159 | |
| sequence |
GACCGATGATGATCAACCTAAATACTTTCATTCTTCTGATGTGCTACCTCATGGCGCGG
TGTGGAAGCAATTTGGAGACCTAAGCTGAGGAAAT
Box motif
Complementary to target RNA |
| length | 94 |
| organism | Hordeum_vulgare |
| snoRNA name | snoZ159 |
| alias | |
| chromosome ⁄ contig | chr6H |
| locus ⁄ host gene | poly:3:snoZ103 |
| organization | Poly |
| target RNA | |
| modification type | |
| modification site | |
| accession no | |
| orthologs | |
| multiple alignment | |