|
|
| Hordeum_vulgare snoR77Y | |
| sequence |
ATGCCTGTGATGATTAGCTTTATGTTGGAATTACCGTCTGATTCTTAATGACGATATTT
TTGCGGCTTTCTGAGGCATTTA
Box motif
Complementary to target RNA |
| length | 81 |
| organism | Hordeum_vulgare |
| snoRNA name | snoR77Y |
| alias | |
| chromosome ⁄ contig | chr1H |
| locus ⁄ host gene | poly:1:snoR8a |
| organization | Poly |
| target RNA | |
| modification type | |
| modification site | |
| accession no | |
| orthologs | |
| multiple alignment | |