snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD71
sequence
TGTGTGTTGGAGGATGAAAGTACGGAGTGATCCATCGGCTAAGTGTCTTGTCACAATGC
TGACACTCAAACTGCTGACAGCACACG
  Box motif
  Complementary to target RNA
length 86
organism Homo_sapiens
snoRNA name SNORD71
alias HBII-239
chromosome ⁄ contig 16
locus ⁄ host gene AP1G1
organization Intronic
target RNA 5.8S rRNA
modification type C/D
modification site 5.8S:U14
accession no NR_003059,NT_010498
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved