snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD11
sequence
GTGTTCAATGATGATTTCTATTTGTTTGCCTGATTTCCTTTTGGATAATGAAGGCATCT
TTAGTCACTACCTCTTCTGAGACAC
  Box motif
  Complementary to target RNA
length 84
organism Homo_sapiens
snoRNA name SNORD11
alias HBII-95
chromosome ⁄ contig
locus ⁄ host gene NOP5/NOP58
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G509
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved