snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD2
sequence
AAGTGAAATGATGGCAATCATCTTTCGGGACTGACCTGAAATGAAGAGAATACTCATTG
CTGATCACTTG
  Box motif
  Complementary to target RNA
length 70
organism Homo_sapiens
snoRNA name SNORD2
alias snR39B
chromosome ⁄ contig 3
locus ⁄ host gene EIF4A2
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G1509
accession no NR_002587,NT_005612
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved