snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD6
sequence
GATGTTATGATGATGGGCGAAATGTTCAACTGCTCTGAAGGGGCTGAATGAAAATGGCC
TTTCTGAACATC
  Box motif
  Complementary to target RNA
length 71
organism Homo_sapiens
snoRNA name SNORD6
alias mgh28S-2411
chromosome ⁄ contig 11
locus ⁄ host gene JOSD3
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G2411
accession no AJ609489,NT_167190
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved