snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD9
sequence
CCCCTGTGATGAGTTGCCATGCTAATACGGAGACACCAGGTAGGGAGTTTTACCCTAAC
TTGGGTGTTGTTGAAATAAACTCTTTCTCGTAAATGCTGAGGGG
  Box motif
  Complementary to target RNA
length 103
organism Homo_sapiens
snoRNA name SNORD9
alias mgU6-53B
chromosome ⁄ contig 14
locus ⁄ host gene CHD8
organization Intronic
target RNA U6 snRNA
modification type C/D
modification site U6:A53
accession no NR_003029,NT_026437
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved