snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD4A
sequence
GGTGCAGATGATGACACTGTAAAGCGACCAAAGTCTGAACAAAGTGATTGGTACCTCGT
TGTCTGATGCACC
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD4A
alias mgh18S-121,Z17A
chromosome ⁄ contig 17
locus ⁄ host gene RPL23A
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U121
accession no AF221907,NT_010799
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved