snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD42B
sequence
GTGCATATGATGGAAAAGTTTTAATCTCCTGACACTTGTGATGTCTTCAAAGGAACCAC
TGATGCAC
  Box motif
  Complementary to target RNA
length 67
organism Homo_sapiens
snoRNA name SNORD42B
alias U42B
chromosome ⁄ contig 17
locus ⁄ host gene RPL23A
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U116
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved