snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD49A
sequence
TGCTCTGATGAAATCACTAATAGGAAGTGCCGTCAGAAGCGATAACTGACGAAGACTAC
TCCTGTCTGATT
  Box motif
  Complementary to target RNA
length 71
organism Homo_sapiens
snoRNA name SNORD49A
alias U49A
chromosome ⁄ contig 17
locus ⁄ host gene C17orf45
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C4426
accession no X96649,NT_010718
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved