snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD49B
sequence
TGTCCTGATGATACTTGTAATAGGAAGTGCCGTCAGAAGCGATAACTGACGACGTCTAA
TGTCTATCTGACC
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD49B
alias U49B
chromosome ⁄ contig 17
locus ⁄ host gene C17orf45
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C4426
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved