snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD59A
sequence
CCTTCTATGATGATTTTATCAAAATGACTTTCGTTCTTCTGAGTTTGCTGAAGCCACAT
TTAGGTACTGAGAAGG
  Box motif
  Complementary to target RNA
length 75
organism Homo_sapiens
snoRNA name SNORD59A
alias U59A
chromosome ⁄ contig 12
locus ⁄ host gene ATP5B
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A1031
accession no X96659,NT_029419
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved