snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD45A
sequence
GGTCAATGATGTGTTGGCATGTATTATCTGAATCTATTGCTGATGTGTAATAACACTTT
AGCTCTAGAATTACTCTGAGACCT
  Box motif
  Complementary to target RNA
length 83
organism Homo_sapiens
snoRNA name SNORD45A
alias U45A
chromosome ⁄ contig 1
locus ⁄ host gene RABGGTB
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A159,18S:U172
accession no X96644,NT_032977
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved