snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD85
sequence
GACTGGCAAGGATGATACACACTTGCCCTCACTTAGACTATAGTTCACTGATGAGAGCA
TTGTTCTGAGCCAGTC
  Box motif
  Complementary to target RNA
length 75
organism Homo_sapiens
snoRNA name SNORD85
alias HBII-251
chromosome ⁄ contig 1
locus ⁄ host gene PUM1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G601
accession no NR_003066,NT_032977
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved