snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD61
sequence
GCTATGATGAATTTGATTGCATTGATCGTCTGACATGATAATGTATTTTTGTCCTCTAA
GAAGTTCTGAGCTT
  Box motif
  Complementary to target RNA
length 73
organism Homo_sapiens
snoRNA name SNORD61
alias U61
chromosome ⁄ contig X
locus ⁄ host gene RBMX
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U1442
accession no X96661,NT_011786
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved