snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD69
sequence
AATGTGAAGCAAATGATGATAAACTGGATCTGACTGACTGTGCTGAGTCTGTTCAATCC
AACCCTGAGCTTCATGTT
  Box motif
  Complementary to target RNA
length 77
organism Homo_sapiens
snoRNA name SNORD69
alias HBII-210
chromosome ⁄ contig 3
locus ⁄ host gene GNL3
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G4464
accession no NR_003057,NT_022517
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved