snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD19B
sequence
GAAATATGATGAGTGTACAAAATCTTGATTTAAGTGAATGAAAAATTACAAGATCCAAC
TCTGATTTCAGCCAGAGA
  Box motif
  Complementary to target RNA
length 77
organism Homo_sapiens
snoRNA name SNORD19B
alias HBII-108B
chromosome ⁄ contig 3
locus ⁄ host gene GNL3
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G683
accession no AM413023
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved