snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD19
sequence
ACATGGGTGAGGTACGAGGAAACAGTCTGATAGTCACTGAAGACTGATTAGATCCAACT
CTGATCTCAGCAAAGCC
  Box motif
  Complementary to target RNA
length 76
organism Homo_sapiens
snoRNA name SNORD19
alias HBII-108
chromosome ⁄ contig 3
locus ⁄ host gene GNL3
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G683
accession no NR_003047,NT_022517
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved