snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD111
sequence
CAGCCTGAAATGATGACTCTTTAAAAAATTTCATGTCTCTTCTCTGACATTTTTCTCTG
GACACAGTTTTTGCCTTATGAATCTGATCAGGCTG
  Box motif
  Complementary to target RNA
length 94
organism Homo_sapiens
snoRNA name SNORD111
alias HBII-82
chromosome ⁄ contig 16
locus ⁄ host gene SF3B3
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G3923
accession no NR_003079,NT_010498
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved