snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD62B
sequence
TCTCAGTGATGTAATTCCAATAGATCCTTCTGACCCTCCACTGTGGACTCAATAGCAGG
GAGATGAAGAGGACAGTGACTGAGAGA
  Box motif
  Complementary to target RNA
length 86
organism Homo_sapiens
snoRNA name SNORD62B
alias U62B
chromosome ⁄ contig 9
locus ⁄ host gene KIAA0515
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A590
accession no U72851
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved