snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD88A
sequence
CCGGGGCCTCCATGATGTCCAGCACTGGGCTCCGACTGCCACTGAGGACACGGTGCCCC
CCGGGACCTTTGACACCCGGGGGTCTGAGGGGCCCTGG
  Box motif
  Complementary to target RNA
length 97
organism Homo_sapiens
snoRNA name SNORD88A
alias HBII-180A
chromosome ⁄ contig 19
locus ⁄ host gene C19orf48
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C3680
accession no NR_003067,NT_011109
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved