snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD35B
sequence
GGCAGATGATGTTTGTTTTCACGATGGTCTTCAGATGCCCACGTGGGCACTGCTGAGAA
AGCCACTTGGTAAAACTGATGCCGGAAA
  Box motif
  Complementary to target RNA
length 87
organism Homo_sapiens
snoRNA name SNORD35B
alias U35B
chromosome ⁄ contig 19
locus ⁄ host gene RPS11
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C4506
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved