snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD35A
sequence
GGCAGATGATGTCCTTATCTCACGATGGTCTGCGGATGTCCCTGTGGGAATGGCGACAA
TGCCAATGGCTTAGCTGATGCCAGGAG
  Box motif
  Complementary to target RNA
length 86
organism Homo_sapiens
snoRNA name SNORD35A
alias U35A
chromosome ⁄ contig 19
locus ⁄ host gene RPL13A
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C4506
accession no NR_000018,NT_011109
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved