snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD41
sequence
TGGGAAGTGATGACACCTGTGACTGTTGATGTGGAACTGATTTATCGCGTATTCGTACT
GGCTGATCCTG
  Box motif
  Complementary to target RNA
length 70
organism Homo_sapiens
snoRNA name SNORD41
alias U41
chromosome ⁄ contig 19
locus ⁄ host gene TNPO2
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:U4276
accession no X96640,NT_011295
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved