snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD105
sequence
CCCCTATCTCTCATGATGAACACATATGCCTCTGAGCTGCTGTGATTTCTGGCTTCAAA
GTAAACGCTCTGAAGAAGAGATGGGG
  Box motif
  Complementary to target RNA
length 85
organism Homo_sapiens
snoRNA name SNORD105
alias U105
chromosome ⁄ contig 19
locus ⁄ host gene P2RY11
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U799
accession no AY349606,NT_011295
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved