snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD95
sequence
GCGGTGATGACCCCAACATGCCATCTGAGTGTCGGTGCTGAAATCCAGAGGCTGTTTCT
GAGC
  Box motif
  Complementary to target RNA
length 63
organism Homo_sapiens
snoRNA name SNORD95
alias U95
chromosome ⁄ contig 5
locus ⁄ host gene GNB2L1
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A2802,28S:C2811
accession no AY349594,NT_023133
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved