snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD72
sequence
AGCTTATCAGTGATGTTGTAAAAATAAATGTCTGAACATATGAATGCAGTATTGATTTC
AGCATTTAACTGAGATAAGCG
  Box motif
  Complementary to target RNA
length 80
organism Homo_sapiens
snoRNA name SNORD72
alias HBII-240
chromosome ⁄ contig 5
locus ⁄ host gene RPL37
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:U4590
accession no NR_002583,NT_006576
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved