snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD100
sequence
GCTGTACATGATGACAACTGGCTCCCTCTACTGAACTGCCATGAGGAAACTGCCATGTC
ACCCTTCTGATTACAGC
  Box motif
  Complementary to target RNA
length 76
organism Homo_sapiens
snoRNA name SNORD100
alias HBII-429
chromosome ⁄ contig 6
locus ⁄ host gene RPS12
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G436
accession no NR_002435,NT_025741
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved