snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD101
sequence
GTTTGAATGATGACTTTAATTGTCGGATACCCCTTCACTCCTTTTATGAGTGAAACATA
AGAGTCTGACAAAC
  Box motif
  Complementary to target RNA
length 73
organism Homo_sapiens
snoRNA name SNORD101
alias U101
chromosome ⁄ contig 6
locus ⁄ host gene RPS12
organization Intronic
target RNA Unknown
modification type C/D
modification site
accession no NR_002434,NT_025741
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved