snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD52
sequence
GGGAATGATGATTTCACAGACTAGAGTCTCCGATGCTGGTCATGATGTCAAAACTAAGT
TCTGA
  Box motif
  Complementary to target RNA
length 64
organism Homo_sapiens
snoRNA name SNORD52
alias U52
chromosome ⁄ contig 6
locus ⁄ host gene C6orf48
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:U3904
accession no X96651,NT_167248
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved