snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD48
sequence
AGTGATGATGACCCCAGGTAACTCTTGAGTGTGTCGCTGATGCCATCACCGCAGCGCTC
TGACC
  Box motif
  Complementary to target RNA
length 64
organism Homo_sapiens
snoRNA name SNORD48
alias U48
chromosome ⁄ contig 6
locus ⁄ host gene C6orf48
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C2279
accession no X96648,NT_007592
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved