snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD84
sequence
GCCATATGATGTTTTCTTTTCGAAAGGTGAGCGCTTTGCGCAGTGATGACCCTCATCTA
TCACCCTTGACTGATGGCT
  Box motif
  Complementary to target RNA
length 78
organism Homo_sapiens
snoRNA name SNORD84
alias U84
chromosome ⁄ contig 6
locus ⁄ host gene BAT1
organization Intronic
target RNA Unknown
modification type C/D
modification site
accession no NR_003065,NT_167248
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved