snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD18B
sequence
TCAAAATGATGAGATTCCACTTAATTGGTCCGTGTTTCTGAAACACATGATATTTGTGG
AAATTCTGACTTG
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD18B
alias U18B
chromosome ⁄ contig 15
locus ⁄ host gene RPL4
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A1313
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved