snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD20
sequence
TGGATATGATGACTGATTACCTGAGAAATAATTGATGAAATCTCAAGAAAATTCCTCTA
GATAGTCAAGTTCTGATCCAG
  Box motif
  Complementary to target RNA
length 80
organism Homo_sapiens
snoRNA name SNORD20
alias U20
chromosome ⁄ contig 2
locus ⁄ host gene NCL
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U1805
accession no Z34290,NT_005403
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved