snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD53
sequence
ATGCTATGATGACATCCATATGGTTTCGCTGCTGGCTGAGTTTCAGAGATGACACCTTT
CTCTTGGCTGTCTGAGCAT
  Box motif
  Complementary to target RNA
length 78
organism Homo_sapiens
snoRNA name SNORD53
alias U53
chromosome ⁄ contig 2
locus ⁄ host gene WDR43
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C3848
accession no X96652,NT_022184
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved