snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD110
sequence
TTGCAGTGATGACTTGCGAATCAAATCTGTCAATCCCCTGAGTGCAATCACTGATGTCT
CCATGTCTCTGAGCAA
  Box motif
  Complementary to target RNA
length 75
organism Homo_sapiens
snoRNA name SNORD110
alias HBII-55
chromosome ⁄ contig 20
locus ⁄ host gene NOL5A
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U1288
accession no NR_003078,NT_011387
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved