snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD98
sequence
GAGTTATGATGTGTGTAAATCCTATTCCATTGCTGAAATGCAGTGTGGAACACAATGAA
CTGAACTC
  Box motif
  Complementary to target RNA
length 67
organism Homo_sapiens
snoRNA name SNORD98
alias HBII-419
chromosome ⁄ contig 10
locus ⁄ host gene CCAR1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G867
accession no NR_003076,NT_030059
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved