snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD58A
sequence
CTGCAGTGATGACTTTCTTAGGACACCTTTGGATTTACCGTGAAAATTAATAAATTCTG
AGCAGC
  Box motif
  Complementary to target RNA
length 65
organism Homo_sapiens
snoRNA name SNORD58A
alias U58A
chromosome ⁄ contig 18
locus ⁄ host gene RPL17
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:U4197,28S:G4198
accession no X96657,NT_010966
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved